addgene pls scel (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
addgene pls scel
Addgene Pls Scel, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+addgene/pLS-SceI+(Plasmid+%23137725)/pmc13657374-119-6-6
Average 95 stars, based on 50 article reviews
Addgene Pls Scel, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+addgene/pLS-SceI+(Plasmid+%23137725)/pmc13657374-119-6-6
Average 95 stars, based on 50 article reviews
addgene pls scel - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Sequencing:Article Title: Non-canonical cytokinesis driven by mechanical uncoupling via nematic flows and adhesion-based invagination Article Snippet: .. To synthesize messenger RNA (mRNA) for the active RhoA sensor mNeonGreen-2xrGBD , the coding sequence was amplified from the Article Title: Functional deletion of α7 nicotinic acetylcholine receptor impairs Ca 2+ -dependent glutamatergic synaptic transmission by affecting both presynaptic and postsynaptic protein expression and function Article Snippet: In order to overexpress CHRNA7 we used the purchased plasmid Addgene #62276. .. To generate plasmids capable of overexpressing CHRNA7 selectively in neurons, the CHRNA7 coding sequence from Article Title: AAV.PHP.eB-based strategies for precise modulation of α7 nicotinic acetylcholine receptor in neurons and astrocytes in the adult mouse brain. Article Snippet: .. Plasmid design and viral vector assembly for CHRNA7 overexpression or silencing To generate plasmids capable of overexpressing CHRNA7 selectively in neurons and astrocytes, the CHRNA7 coding sequence from Article Title: Synthetic miniature Crispr-Cas (CasMINI) system for eukaryotic genome engineering Article Snippet: .. Specifically, the Cas14 sequence was amplified from Amplification:Article Title: Non-canonical cytokinesis driven by mechanical uncoupling via nematic flows and adhesion-based invagination Article Snippet: .. To synthesize messenger RNA (mRNA) for the active RhoA sensor mNeonGreen-2xrGBD , the coding sequence was amplified from the Article Title: Functional deletion of α7 nicotinic acetylcholine receptor impairs Ca 2+ -dependent glutamatergic synaptic transmission by affecting both presynaptic and postsynaptic protein expression and function Article Snippet: In order to overexpress CHRNA7 we used the purchased plasmid Addgene #62276. .. To generate plasmids capable of overexpressing CHRNA7 selectively in neurons, the CHRNA7 coding sequence from Article Title: AI-driven identification of a selective dual function inhibitor blocking HK2 activity and HK2-VDAC1 interaction displaying enhanced anticancer efficacy under hypoxia. Article Snippet: Selective inhibition of hexokinase 2 (HK2) represents a promising therapeutic strategy due to the pivotal role of HK2 in the Warburg effect, enhancement of glycolysis and anti-apoptosis via HK2-Voltage-Dependent Anion Channel 1 (VDAC1) protein-protein interaction.. Moreover, HK2 initiates glycolysis to generate lactate, hence this central enzyme can be pharmacologically targeted to enhance therapy outcomes.. Currently, no HK2 inhibitors (HK2is) exist in the clinic. Article Title: AAV.PHP.eB-based strategies for precise modulation of α7 nicotinic acetylcholine receptor in neurons and astrocytes in the adult mouse brain. Article Snippet: .. Plasmid design and viral vector assembly for CHRNA7 overexpression or silencing To generate plasmids capable of overexpressing CHRNA7 selectively in neurons and astrocytes, the CHRNA7 coding sequence from Article Title: Synthetic miniature Crispr-Cas (CasMINI) system for eukaryotic genome engineering Article Snippet: .. Specifically, the Cas14 sequence was amplified from Plasmid Preparation:Article Title: Non-canonical cytokinesis driven by mechanical uncoupling via nematic flows and adhesion-based invagination Article Snippet: .. To synthesize messenger RNA (mRNA) for the active RhoA sensor mNeonGreen-2xrGBD , the coding sequence was amplified from the Article Title: AsCas12a tolerates insertions in target DNA Article Snippet: .. 120 ssDNA-0nt insert CTCTCCCAGGACACACACCT Fig. S8 121 ssDNA-2nt insert CTCTCCCAGGTTACACACACCT Fig. S8 122 ssDNA-4nt insert CTCTCCCAGGTTTTACACACACCT Fig. S8 123 ssDNA-6nt insert CTCTCCCAGGTTTTTTACACACACCT Fig. S8 124 ssDNA-8nt insert CTCTCCCAGGTTTTTTTTACACACACCT Fig. S8 125 ssDNA-10nt insert CTCTCCCAGGTTTTTTTTTTACACACACCT Fig. S7, S8 126 Supercoiled Article Title: LAMP2A Regulates Endosomal Protein Composition and Membrane Identity in Exosome Biogenesis Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD63 antibody SICGEN AB0047 Anti-CD63 antibody (IF) Santa Cruz Biotechnology MX-49.129.5 Anti-EEA1 antibody SICGEN AB0006-200 Anti-Rab27A antibody SICGEN AB0045 Anti-Rab27B antibody SICGEN AB0072 Anti-actin antibody Thermo Fisher MA1-744 Anti-Cathepsin B antibody Santa Cruz Biotechnology SC-6493 Anti-LAMP2A antibody Abcam AB125068 Anti-Rab7 antibody SICGEN AB0033 Anti-Rab3 antibody SICGEN AB10032 Anti-RPN1 antibody Invitrogen MA5-25710 Anti-TOMM20 antibody Abcam AB186734 Anti-Rab8 antibody SICGEN AB3176 Anti-Rab35 antibody SICGEN AB0198 Cy5 antibody Abcam AB6566 Cy3 antibody Abcam AB97035 HRP antibody Bio-Rad 170–6516 Rabbit anti-goat Bio-Rad 172–1034 Goat anti-rabbit Bio-Rad 170–6515 Pierce BCA Protein Assay Kit Thermo Fisher 23225 ARPE-19 cell line ATCC ATCC-CRL-2302 pLenti6 vector Thermo Fisher V49610 pMD2.G plasmid Addgene # Article Title: Functional deletion of α7 nicotinic acetylcholine receptor impairs Ca 2+ -dependent glutamatergic synaptic transmission by affecting both presynaptic and postsynaptic protein expression and function Article Snippet: In order to overexpress CHRNA7 we used the purchased plasmid Addgene #62276. .. To generate plasmids capable of overexpressing CHRNA7 selectively in neurons, the CHRNA7 coding sequence from Article Title: AI-driven identification of a selective dual function inhibitor blocking HK2 activity and HK2-VDAC1 interaction displaying enhanced anticancer efficacy under hypoxia. Article Snippet: Selective inhibition of hexokinase 2 (HK2) represents a promising therapeutic strategy due to the pivotal role of HK2 in the Warburg effect, enhancement of glycolysis and anti-apoptosis via HK2-Voltage-Dependent Anion Channel 1 (VDAC1) protein-protein interaction.. Moreover, HK2 initiates glycolysis to generate lactate, hence this central enzyme can be pharmacologically targeted to enhance therapy outcomes.. Currently, no HK2 inhibitors (HK2is) exist in the clinic. Article Title: AAV.PHP.eB-based strategies for precise modulation of α7 nicotinic acetylcholine receptor in neurons and astrocytes in the adult mouse brain. Article Snippet: .. Plasmid design and viral vector assembly for CHRNA7 overexpression or silencing To generate plasmids capable of overexpressing CHRNA7 selectively in neurons and astrocytes, the CHRNA7 coding sequence from Article Title: Synthetic miniature Crispr-Cas (CasMINI) system for eukaryotic genome engineering Article Snippet: .. Specifically, the Cas14 sequence was amplified from Article Title: Dopaminergic Modulation of Striatal Somatostatin Interneurons Shapes Motor Learning and L-DOPA-Induced Dyskinesia. Article Snippet: Somatostatin-expressing low-threshold spiking interneurons (SOM-INs) constitute a key inhibitory population in the dorsal striatum, yet their contribution to parkinsonian states and L-DOPA-induced dyskinesia (LID) remains poorly understood.. Here, we combined in vivo behavioral assays, chemogenetics, and ex vivo electrophysiology to examine how nigrostriatal dopamine loss and dopaminergic therapy shape SOM-INs’ activity and function.. During LID, SOM-INs displayed increased c-Fos expression, revealing their recruitment during dyskinetic states. Polymerase Chain Reaction:Article Title: Non-canonical cytokinesis driven by mechanical uncoupling via nematic flows and adhesion-based invagination Article Snippet: .. To synthesize messenger RNA (mRNA) for the active RhoA sensor mNeonGreen-2xrGBD , the coding sequence was amplified from the Article Title: Functional deletion of α7 nicotinic acetylcholine receptor impairs Ca 2+ -dependent glutamatergic synaptic transmission by affecting both presynaptic and postsynaptic protein expression and function Article Snippet: In order to overexpress CHRNA7 we used the purchased plasmid Addgene #62276. .. To generate plasmids capable of overexpressing CHRNA7 selectively in neurons, the CHRNA7 coding sequence from Article Title: AI-driven identification of a selective dual function inhibitor blocking HK2 activity and HK2-VDAC1 interaction displaying enhanced anticancer efficacy under hypoxia. Article Snippet: Selective inhibition of hexokinase 2 (HK2) represents a promising therapeutic strategy due to the pivotal role of HK2 in the Warburg effect, enhancement of glycolysis and anti-apoptosis via HK2-Voltage-Dependent Anion Channel 1 (VDAC1) protein-protein interaction.. Moreover, HK2 initiates glycolysis to generate lactate, hence this central enzyme can be pharmacologically targeted to enhance therapy outcomes.. Currently, no HK2 inhibitors (HK2is) exist in the clinic. Article Title: AAV.PHP.eB-based strategies for precise modulation of α7 nicotinic acetylcholine receptor in neurons and astrocytes in the adult mouse brain. Article Snippet: .. Plasmid design and viral vector assembly for CHRNA7 overexpression or silencing To generate plasmids capable of overexpressing CHRNA7 selectively in neurons and astrocytes, the CHRNA7 coding sequence from Cloning:Article Title: Non-canonical cytokinesis driven by mechanical uncoupling via nematic flows and adhesion-based invagination Article Snippet: .. To synthesize messenger RNA (mRNA) for the active RhoA sensor mNeonGreen-2xrGBD , the coding sequence was amplified from the Bicinchoninic Acid Protein Assay:Article Title: LAMP2A Regulates Endosomal Protein Composition and Membrane Identity in Exosome Biogenesis Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD63 antibody SICGEN AB0047 Anti-CD63 antibody (IF) Santa Cruz Biotechnology MX-49.129.5 Anti-EEA1 antibody SICGEN AB0006-200 Anti-Rab27A antibody SICGEN AB0045 Anti-Rab27B antibody SICGEN AB0072 Anti-actin antibody Thermo Fisher MA1-744 Anti-Cathepsin B antibody Santa Cruz Biotechnology SC-6493 Anti-LAMP2A antibody Abcam AB125068 Anti-Rab7 antibody SICGEN AB0033 Anti-Rab3 antibody SICGEN AB10032 Anti-RPN1 antibody Invitrogen MA5-25710 Anti-TOMM20 antibody Abcam AB186734 Anti-Rab8 antibody SICGEN AB3176 Anti-Rab35 antibody SICGEN AB0198 Cy5 antibody Abcam AB6566 Cy3 antibody Abcam AB97035 HRP antibody Bio-Rad 170–6516 Rabbit anti-goat Bio-Rad 172–1034 Goat anti-rabbit Bio-Rad 170–6515 Pierce BCA Protein Assay Kit Thermo Fisher 23225 ARPE-19 cell line ATCC ATCC-CRL-2302 pLenti6 vector Thermo Fisher V49610 pMD2.G plasmid Addgene # Staining:Article Title: LAMP2A Regulates Endosomal Protein Composition and Membrane Identity in Exosome Biogenesis Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD63 antibody SICGEN AB0047 Anti-CD63 antibody (IF) Santa Cruz Biotechnology MX-49.129.5 Anti-EEA1 antibody SICGEN AB0006-200 Anti-Rab27A antibody SICGEN AB0045 Anti-Rab27B antibody SICGEN AB0072 Anti-actin antibody Thermo Fisher MA1-744 Anti-Cathepsin B antibody Santa Cruz Biotechnology SC-6493 Anti-LAMP2A antibody Abcam AB125068 Anti-Rab7 antibody SICGEN AB0033 Anti-Rab3 antibody SICGEN AB10032 Anti-RPN1 antibody Invitrogen MA5-25710 Anti-TOMM20 antibody Abcam AB186734 Anti-Rab8 antibody SICGEN AB3176 Anti-Rab35 antibody SICGEN AB0198 Cy5 antibody Abcam AB6566 Cy3 antibody Abcam AB97035 HRP antibody Bio-Rad 170–6516 Rabbit anti-goat Bio-Rad 172–1034 Goat anti-rabbit Bio-Rad 170–6515 Pierce BCA Protein Assay Kit Thermo Fisher 23225 ARPE-19 cell line ATCC ATCC-CRL-2302 pLenti6 vector Thermo Fisher V49610 pMD2.G plasmid Addgene # Membrane:Article Title: LAMP2A Regulates Endosomal Protein Composition and Membrane Identity in Exosome Biogenesis Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Anti-CD63 antibody SICGEN AB0047 Anti-CD63 antibody (IF) Santa Cruz Biotechnology MX-49.129.5 Anti-EEA1 antibody SICGEN AB0006-200 Anti-Rab27A antibody SICGEN AB0045 Anti-Rab27B antibody SICGEN AB0072 Anti-actin antibody Thermo Fisher MA1-744 Anti-Cathepsin B antibody Santa Cruz Biotechnology SC-6493 Anti-LAMP2A antibody Abcam AB125068 Anti-Rab7 antibody SICGEN AB0033 Anti-Rab3 antibody SICGEN AB10032 Anti-RPN1 antibody Invitrogen MA5-25710 Anti-TOMM20 antibody Abcam AB186734 Anti-Rab8 antibody SICGEN AB3176 Anti-Rab35 antibody SICGEN AB0198 Cy5 antibody Abcam AB6566 Cy3 antibody Abcam AB97035 HRP antibody Bio-Rad 170–6516 Rabbit anti-goat Bio-Rad 172–1034 Goat anti-rabbit Bio-Rad 170–6515 Pierce BCA Protein Assay Kit Thermo Fisher 23225 ARPE-19 cell line ATCC ATCC-CRL-2302 pLenti6 vector Thermo Fisher V49610 pMD2.G plasmid Addgene # Derivative Assay:Article Title: AI-driven identification of a selective dual function inhibitor blocking HK2 activity and HK2-VDAC1 interaction displaying enhanced anticancer efficacy under hypoxia. Article Snippet: Selective inhibition of hexokinase 2 (HK2) represents a promising therapeutic strategy due to the pivotal role of HK2 in the Warburg effect, enhancement of glycolysis and anti-apoptosis via HK2-Voltage-Dependent Anion Channel 1 (VDAC1) protein-protein interaction.. Moreover, HK2 initiates glycolysis to generate lactate, hence this central enzyme can be pharmacologically targeted to enhance therapy outcomes.. Currently, no HK2 inhibitors (HK2is) exist in the clinic. Over Expression:Article Title: AAV.PHP.eB-based strategies for precise modulation of α7 nicotinic acetylcholine receptor in neurons and astrocytes in the adult mouse brain. Article Snippet: .. Plasmid design and viral vector assembly for CHRNA7 overexpression or silencing To generate plasmids capable of overexpressing CHRNA7 selectively in neurons and astrocytes, the CHRNA7 coding sequence from Generated:Article Title: Synthetic miniature Crispr-Cas (CasMINI) system for eukaryotic genome engineering Article Snippet: .. Specifically, the Cas14 sequence was amplified from Expressing:Article Title: Dopaminergic Modulation of Striatal Somatostatin Interneurons Shapes Motor Learning and L-DOPA-Induced Dyskinesia. Article Snippet: Somatostatin-expressing low-threshold spiking interneurons (SOM-INs) constitute a key inhibitory population in the dorsal striatum, yet their contribution to parkinsonian states and L-DOPA-induced dyskinesia (LID) remains poorly understood.. Here, we combined in vivo behavioral assays, chemogenetics, and ex vivo electrophysiology to examine how nigrostriatal dopamine loss and dopaminergic therapy shape SOM-INs’ activity and function.. During LID, SOM-INs displayed increased c-Fos expression, revealing their recruitment during dyskinetic states. |